rs76077203 chr9:89770896 G>A
- Sequence
agcatccttttaagctttgatggt[G/A]ggtgggaaggagtccaaggagcac
- ASB in cell types
- monocyte-derived macrophages from peripheral blood MDM(monocyte derived macrophages)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| monocyte-derived macrophages from peripheral blood | 2.40 | -1.31 | 2.00 | |||
| MDM(monocyte derived macrophages) | 1.62 | -4.41 | 2.33 |
Items per page:
1 – 2 of 2