rs76087266 chr13:42216212 A>G
- Sequence
atggatctcaagcataaatgctgg[A/G]agcttgtggatgtcctattttgtt
- ASB in cell types
- GM18486 (Lymphoblastoid Cell Lines) GM19193 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18486 (Lymphoblastoid Cell Lines) | -0.22 | 1.47 | 1.00 | |||
| GM19193 (female B-cells Lymphoblastoid Cell Lines) | 1.07 | -0.51 | 1.00 |
Items per page:
1 – 2 of 2