rs76108783 chr2:127695749 G>A
- Sequence
ggacgcgtaaggagaaaaccgggg[G/A]agggccccgcacgccgctgccccc
- ASB in cell types
- HUES64 (embryonic stem cells) tibial artery
- ASB for transcription factors
- RAD21_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RAD21_HUMAN | -0.79 | 2.54 | 1.25 | n/a | n/a | |||
| CTCF_HUMAN | 0.86 | 1.41 | 1.94 | -3.07 | Discordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Esophagus_Muscularis, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid