rs761098 chr6:2448952 A>C
- Sequence
aacagcaccctccactggtcgcta[A/C]aggaaagtgtgcttttgtgatgtg
- ASB in cell types
- hepatocytes HUVEC-C (HUVEC, umbilical vein endothelial cells) GM18505 (female B-cells Lymphoblastoid Cell Lines) A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| hepatocytes | -0.38 | 1.73 | 1.00 | |||
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | 2.10 | -0.15 | 1.67 | |||
| GM18505 (female B-cells Lymphoblastoid Cell Lines) | 0.98 | -0.46 | 1.00 | |||
| A549 (lung carcinoma) | 0.87 | 0.77 | 1.00 | |||
| GM18526 (B – cells Lymphoblastoid Cell Lines) | -0.42 | 0.85 | 1.00 |
Items per page:
1 – 5 of 7