rs76118363 chr7:13278201 C>T
- Sequence
cagaccagtcaagagcaaaagtca[C/T]ggaaatggccttttgggatgctcc
- ASB in cell types
- SK-BR-3 (breast adenocarcinoma) T47D (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| SK-BR-3 (breast adenocarcinoma) | 1.59 | -0.14 | 2.00 | |||
| T47D (invasive ductal carcinoma) | 0.65 | -0.01 | 1.42 |
Items per page:
1 – 2 of 2