rs76138569 chr14:25042951 T>C
- Sequence
accaccacaagaaccctctttaaa[T/C]agagattttttaaaaagagggagg
- ASB in cell types
- GM02255 (Lymphoblastoid Cell Lines) GM19193 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02255 (Lymphoblastoid Cell Lines) | 1.70 | -0.73 | 1.00 | |||
| GM19193 (female B-cells Lymphoblastoid Cell Lines) | -0.16 | 2.29 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Skin_Sun_Exposed_Lower_leg