rs76163903 chr12:109093535 G>A
- Sequence
ctgggaactacggcaggctagggc[G/A]caaagagagcagccgggcggcccc
- ASB in cell types
- HCT-116 (colon carcinoma) 22RV1 (prostate carcinoma) LNCaP (prostate carcinoma) CD34+ stem cells-derived erythroblasts
- ASB for transcription factors
- CTCF_HUMAN TBP_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.94 | 0.15 | 1.35 | n/a | No Hit | |||
| TBP_HUMAN | 1.03 | -0.18 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2