rs761723 chr20:23350083 A>G
- Sequence
gcccctcaagcctcagggcagtgg[A/G]gagccgccgtcacgcccccgcctc
- ASB in cell types
- HEK293 (embryonic kidney) foreskin keratinocyte primary B-CLL cells
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.08 | 0.96 | 1.98 | |||
| foreskin keratinocyte | -2.10 | 1.79 | 1.39 | |||
| primary B-CLL cells | 1.36 | -0.84 | 3.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Caudate_basal_ganglia, Brain_Cerebellum, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis