rs7620 chr16:12574088 C>T
- Sequence
aagtctgtggaaacgccctgaaac[C/T]tgtagtattatcttaactaccctc
- ASB in cell types
- GM18486 (Lymphoblastoid Cell Lines) ID00014 (lymphoblastoid cell, DiGeorge syndrome) HeLa (cervical adenocarcinoma) epithelial cell of prostate
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18486 (Lymphoblastoid Cell Lines) | 1.38 | -2.18 | 1.33 | |||
| ID00014 (lymphoblastoid cell, DiGeorge syndrome) | 1.97 | -1.57 | 1.00 | |||
| HeLa (cervical adenocarcinoma) | -0.66 | 1.58 | 1.20 | |||
| epithelial cell of prostate | -1.36 | 1.36 | 1.00 |
Items per page:
1 – 4 of 4