rs76252336 chr13:45047510 C>A
- Sequence
ggaaatgttagcgattccacaagg[C/A]ggcactagagttccacctgtctcc
- ASB in cell types
- GM02630 (Fanconi anemi) GM18505 (female B-cells Lymphoblastoid Cell Lines) 2588 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 0.44 | -0.31 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1