rs76253670 chr5:32928957 A>C
- Sequence
gcttcatttccttccccaggatga[A/C]tcatgatagggacatctatgttct
- ASB in cell types
- HCASMC (Human coronary artery smooth muscle cells)
- ASB for transcription factors
- JUN_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| JUN_HUMAN | -3.77 | 2.49 | 1.33 | 4.75 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
