rs76275416 chr16:90032062 A>G
- Sequence
tgtagtacaggtgtagtgcaggcg[A/G]ccaggtgtgtacgggaatttacag
- ASB in cell types
- HMEC (human mammary epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HMEC (human mammary epithelial cells) | 2.33 | -1.93 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Nerve_Tibial, Stomach