rs76277201 chr6:20550613 G>A
- Sequence
tcaatatgcttgctcgttgccacc[G/A]tgaggtgtcgctgttgtgaggtcc
- ASB in cell types
- ID00014 (lymphoblastoid cell, DiGeorge syndrome) epithelial cell of prostate neural progenitors GM18951 (B-cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.45 | 1.69 | 1.76 | 1.62 | Weak Concordant | |||
| STAG1_HUMAN | -0.46 | 1.60 | 2.33 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
