rs76280926 chr1:52726410 T>G
- Sequence
ctgcgcattgagagcggaggcggg[T/G]ccaggcgcgggctcgcgcgcccgg
- ASB in cell types
- GM01310 ( Transformed lymphovlasoid cell line )
- ASB for transcription factors
- ZFX_HUMAN AHR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZFX_HUMAN | -0.47 | 1.19 | 1.00 | n/a | No Hit | |||
| AHR_HUMAN | 1.83 | -0.27 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Brain_Amygdala, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Esophagus_Mucosa, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood