rs76298426 chr2:63060193 T>C
- Sequence
cgttcagacgtcaacagttttctt[T/C]ctttgagtggtcaacgaaaacttg
- ASB in cell types
- HDF(human dermal fibroblasts)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HDF(human dermal fibroblasts) | 1.64 | -1.48 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Coronary, Cells_Cultured_fibroblasts, Spleen, Testis, Thyroid, Whole_Blood