rs76301015 chr12:27975899 G>A
- Sequence
tatggagtttgtaaattgcgcaga[G/A]ctggctgggggaagccagtgagct
- ASB in cell types
- HEK293 (embryonic kidney) primary human epidermal keratinocytes WA01 (H1, human embryonic stem cells)
- ASB for transcription factors
- REST_HUMAN BRD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| REST_HUMAN | 1.41 | 0.64 | 1.33 | n/a | No Hit | |||
| BRD4_HUMAN | 1.24 | -0.87 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2