rs76302215 chr5:174327433 G>T
- Sequence
tttttattattagcctgcagctaa[G/T]gcctctcccttgaagcggcttctc
- ASB in cell types
- epidermal keratinocytes THP-1 (acute monocytic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| epidermal keratinocytes | 2.90 | n/a | 2.00 | |||
| THP-1 (acute monocytic leukemia) | 0.77 | 0.69 | 1.00 |
Items per page:
1 – 2 of 2