rs76321546 chr4:38858178 A>G
- Sequence
atggcaatgacagttaagcaaaca[A/G]agaaacagacagtactgggccgaa
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) CFPAC-1(pancreatic ductal adenocarcinoma) CD14+ monocytes
- ASB for transcription factors
- STAT1_HUMAN FOXA2_HUMAN ZN687_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 1.93 | -0.81 | 1.67 | -0.04 | Weak Concordant | |||
| FOXA2_HUMAN | 1.56 | 0.06 | 1.20 | 0.37 | Weak Discordant | |||
| ZN687_HUMAN | 2.12 | -1.78 | 1.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Esophagus_Mucosa, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis