rs76335243 chr19:1930490 A>T
- Sequence
tgtgtgtgtgtgtgtgtgtgagag[A/T]gagagagagagagacagacagaga
- ASB in cell types
- MS-1 (Small cell lung carcinoma) GBM39 (Human brain tumor)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MS-1 (Small cell lung carcinoma) | -1.18 | 1.98 | 1.00 | |||
| GBM39 (Human brain tumor) | 1.45 | 0.15 | 1.00 |
Items per page:
1 – 2 of 2