rs76337954 chr7:52168309 A>C
- Sequence
ggaggaacagagaacagcaccctc[A/C]cccaagctttccaaagagcattct
- ASB in cell types
- adrenal gland transverse colon T47D (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| adrenal gland | 2.09 | -0.95 | 1.00 | |||
| transverse colon | 2.42 | -2.26 | 1.00 | |||
| T47D (invasive ductal carcinoma) | 1.17 | 0.24 | 1.07 |
Items per page:
1 – 3 of 3