rs76364243 chr8:61367173 T>C
- Sequence
tgctcgactccagtcccctgcctt[T/C]gatgcacatagttcctgctgccag
- ASB in cell types
- MOLM-13(acute monocytic leukemia(AML), Homo sapiens)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MOLM-13(acute monocytic leukemia(AML), Homo sapiens) | 2.07 | -0.62 | 2.25 |
Items per page:
1 – 1 of 1