rs763725 chr6:84883313 C>T
- Sequence
aaatttactttgaaaactgaggca[C/T]accaaaattttattaggtgaaact
- ASB for transcription factors
- GLI2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GLI2_HUMAN | 2.41 | -2.01 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), aortic valve calcium, college completion, cystatin c in serum, obesity with early age of onset (age >2), years of education