rs76378029 chr8:28412210 G>T
- Sequence
agggggcaggccatgcctgcggcc[G/T]caacgctcgggtctcgctgccggc
- ASB in cell types
- breast tumor NB69 (neuroblastoma) neutrophils
- ASB for transcription factors
- ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 2.59 | 0.23 | 1.20 | n/a | No Hit |
Items per page:
1 – 1 of 1