rs76378188 chr19:5794260 G>A
- Sequence
ctgggagaaagttgaggggagagc[G/A]ggcagtttgtcttccatctctggc
- ASB in cell types
- CD34+ stem cells-derived erythroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CD34+ stem cells-derived erythroblasts | 2.58 | -1.59 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Heart_Left_Ventricle, Pancreas, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid, Whole_Blood