rs763811 chr7:28851505 C>T
- Sequence
aaaaatctagattcagacctctga[C/T]tccagtacatggggcttttccatg
- ASB for transcription factors
- MZF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MZF1_HUMAN | 2.54 | -2.58 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1