rs76390481 chr3:119323465 G>T
- Sequence
agacgttgggcttggctttgcttt[G/T]cgtttctttccttttttcttttgt
- ASB in cell types
- primary B-CLL cells
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| primary B-CLL cells | 2.43 | n/a | 2.50 |
Items per page:
1 – 1 of 1