rs76391708 chr7:155805572 T>C
- Sequence
gcacacagcctcgggccggaggtt[T/C]gcgtgcgcgcgatggcgcctcctc
- ASB in cell types
- SMMC-7721 (hepatocellular carcinoma) HeLa (cervical adenocarcinoma)
- ASB for transcription factors
- CATA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CATA_HUMAN | 1.95 | -3.32 | 1.33 | n/a | n/a |
Items per page:
1 – 1 of 1