rs76394459 chr10:5666459 A>T
- Sequence
gccatcggatacgcggccggcctc[A/T]ggagccggcgccgctgcctcgctc
- ASB in cell types
- SEM (childhood B acute lymphoblastic leukemia)
- ASB for transcription factors
- KMT2A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| KMT2A_HUMAN | 2.55 | -0.03 | 1.00 | 1.26 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
