rs76407205 chr19:53820021 C>T
- Sequence
actactactggcacacctcattaa[C/T]gacgagtcattaagctttgcagaa
- ASB in cell types
- HCASMC (Human coronary artery smooth muscle cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HCASMC (Human coronary artery smooth muscle cells) | 1.94 | -2.20 | 1.33 |
Items per page:
1 – 1 of 1