rs76412132 chr15:78738329 C>T
- Sequence
ggtcctgccccctagtggccagag[C/T]cagcttcacaggataagagccagc
- ASB in cell types
- IPSC-derived bipolar neuron GM18526 (B – cells Lymphoblastoid Cell Lines) MS-1 (Small cell lung carcinoma) GM19099 (female B-cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.95 | -0.23 | 3.26 | 0.35 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Cortex, Brain_Substantia_nigra, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Transverse, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Testis