rs76414628 chr1:48217297 C>T
- Sequence
tacaactcctcctccctcctcgaa[C/T]cacagctcctggacgccagactta
- ASB in cell types
- MS-1 (Small cell lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MS-1 (Small cell lung carcinoma) | -1.35 | 1.67 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Breast_Mammary_Tissue, Esophagus_Gastroesophageal_Junction, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid