rs764209 chr5:129345321 A>C
- Sequence
cacctagacccacaaaccagaaaa[A/C]aataatctcaggtcagagacttag
- ASB in cell types
- D283 Med (medulloblastoma)
- ASB for transcription factors
- OTX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| OTX2_HUMAN | 2.59 | n/a | 1.33 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP arthritis including non-rheumatoid, college completion, diabetic retinopathy in type 2 diabetes mellitus, fasting blood glucose, homa-b, ldl cholesterol change with statins, longstanding arthritis, rheumatoid arthritis, schizophrenia, total cholesterol change with statins, urinary albumin-to-creatinine ratio