rs764439 chr20:8458142 C>T
- Sequence
ttgggaagcagatcttgcttcctc[C/T]ggttgattctgagttgaaaggagg
- ASB in cell types
- MV-4-11 (Childhood acute monocytic leukemia)
- ASB for transcription factors
- CDK9_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CDK9_HUMAN | -1.14 | 2.21 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP birth weight, fasting blood glucose, late onset alzheimers disease, obesity with early age of onset (age >2), refractive error