rs76448170 chr12:63844106 G>T
- Sequence
agggaggcagaggcccctcgcggc[G/T]ccggctctggagacctaaactccg
- ASB in cell types
- 22RV1 (prostate carcinoma) HEK293 (embryonic kidney) 2588 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 0.48 | -0.05 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1