rs76468680 chr14:78022256 G>C
- Sequence
aaatgatgcgcttcctgtagcttg[G/C]gcagccatttcagaggctctcaga
- ASB in cell types
- PC9 (lung adenocarcinoma) Ishikawa (endometrial adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| PC9 (lung adenocarcinoma) | 1.13 | -0.44 | 1.00 | |||
| Ishikawa (endometrial adenocarcinoma) | 1.73 | -1.23 | 1.00 |
Items per page:
1 – 2 of 2