rs76478953 chr20:37179882 A>G
- Sequence
aaacttgcagtcggccacgtattc[A/G]ttgtgtaacccaaagcaggttact
- ASB in cell types
- K562 (myelogenous leukemia) HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.09 | 0.74 | 2.00 | |||
| HepG2 (hepatoblastoma) | 0.40 | 0.68 | 1.13 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Caudate_basal_ganglia, Cells_Cultured_fibroblasts, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg