rs76495287 chr19:38335683 C>T
- Sequence
tctgccgaccaggccccgcgccct[C/T]agtgctgagacagcctccagccct
- ASB in cell types
- GM02630 (Fanconi anemi) foreskin keratinocyte GM18951 (B-cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- STAG1_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 0.56 | -0.14 | 1.00 | n/a | n/a | |||
| CTCF_HUMAN | 0.61 | 0.59 | 1.54 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellar_Hemisphere, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid