rs76500946 chr14:92690441 G>A
- Sequence
ctcaccccaatccctgccaatgca[G/A]acagcactcttcctctgcttccaa
- ASB in cell types
- GM02255 (Lymphoblastoid Cell Lines) MCF10AT1 (breast premetastatic epithelial cells) GM10847 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02255 (Lymphoblastoid Cell Lines) | 1.67 | -0.35 | 1.00 | |||
| MCF10AT1 (breast premetastatic epithelial cells) | -1.69 | 2.09 | 1.00 | |||
| GM10847 (female B-cells Lymphoblastoid Cell Lines) | 1.86 | -0.25 | 1.00 |
Items per page:
1 – 3 of 3