rs76502212 chr19:4233534 C>T
- Sequence
ctccacagtctgtccttcccacag[C/T]agccaccagagggcgcctgagagc
- ASB in cell types
- foreskin keratinocyte THP-1 (acute monocytic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.58 | n/a | 2.50 | |||
| THP-1 (acute monocytic leukemia) | 0.54 | 1.02 | 1.05 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Breast_Mammary_Tissue, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood