rs76502338 chr2:158755938 G>A
- Sequence
tgctcgccaagagggggcgcccct[G/A]tgccctcctagtaacacattccta
- ASB in cell types
- MCF7L-P(immortalized breast epithelial cell line) MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- CTCF_HUMAN ZN579_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.55 | 1.73 | 1.48 | n/a | No Hit | |||
| ZN579_HUMAN | -2.02 | 2.42 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Colon_Sigmoid, Esophagus_Mucosa, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid