rs76514883 chr15:70588327 C>T
- Sequence
cccctttgcagaggacgtcctctt[C/T]cctccccaccccacctcatgcgat
- ASB in cell types
- embryonic kidney
- ASB for transcription factors
- GCR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GCR_HUMAN | 2.03 | -2.02 | 1.50 | -2.66 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
