rs765566 chr9:37391038 A>C
- Sequence
ggcttcagtttctccatctataaa[A/C]ctgcagggttggactagaacagtc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) K562 (myelogenous leukemia) pancreas
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | -2.06 | 2.35 | 1.50 | |||
| K562 (myelogenous leukemia) | 0.33 | 0.67 | 1.39 | |||
| pancreas | 2.13 | -1.59 | 1.00 |
Items per page:
1 – 3 of 3