rs76570784 chr11:100980452 G>A
- Sequence
atcataatcaaagaggtaatcccc[G/A]tagagctttaagaaaacaagctat
- ASB in cell types
- foreskin keratinocyte GM18486 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.52 | n/a | 2.67 | |||
| GM18486 (Lymphoblastoid Cell Lines) | -1.33 | 1.91 | 1.00 |
Items per page:
1 – 2 of 2