rs76585892 chr4:68906020 T>G
- Sequence
aactggtttttcctgtggctttct[T/G]tttgtctctgtttgctcacgctac
- ASB in cell types
- breast tumor VCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| breast tumor | 2.61 | -1.40 | 2.00 | |||
| VCaP (prostate carcinoma) | 0.94 | 0.46 | 3.27 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Breast_Mammary_Tissue, Lung, Minor_Salivary_Gland, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid