rs765903 chr7:52018670 T>C
- Sequence
ctcggggattccaagttagagtct[T/C]gcccaccactggctgattgtgctg
- ASB in cell types
- TTC-1240 (Rhabdoid tumor of the kidney) bipolar neuron GM02630 (Fanconi anemi) OCI-LY7 (diffuse large B-cell lymphoma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.17 | 0.40 | 1.56 | 0.97 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
