rs76603099 chr12:120317602 T>C
- Sequence
ctgcgcctgcgcagactcgggttt[T/C]ctgtgcgcgccagaggggcggggc
- ASB in cell types
- HepG2 (hepatoblastoma)
- ASB for transcription factors
- RBM25_HUMAN TYY1_HUMAN GABP1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RBM25_HUMAN | 3.60 | -0.62 | 2.00 | n/a | n/a | |||
| TYY1_HUMAN | 2.94 | -5.17 | 2.00 | n/a | No Hit | |||
| GABP1_HUMAN | -1.44 | 1.72 | 1.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Transverse, Esophagus_Mucosa, Liver, Lung, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Whole_Blood