rs76606067 chr4:52862054 G>T
- Sequence
cttcctggccccgcagccacagca[G/T]ctgccccatgctcgcgcggcagga
- ASB in cell types
- K562 (myelogenous leukemia) GM18486 (Lymphoblastoid Cell Lines) breast tumor
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.33 | 0.20 | 2.10 | -0.68 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Mucosa, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid, Whole_Blood