rs76625474 chr14:91419024 T>G
- Sequence
acagcccagcgctggcggaccccg[T/G]tgggctggggagggttgtgagatt
- ASB in cell types
- CD34+ stem cells-derived erythroblasts MCF7 (Invasive ductal breast carcinoma) CD14+ monocytes HCT-116 (colon carcinoma)
- ASB for transcription factors
- CTCF_HUMAN STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.01 | 0.14 | 1.33 | 2.47 | Discordant | |||
| STAT1_HUMAN | 2.08 | -5.53 | 3.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
