rs76641855 chr7:24981754 G>T
- Sequence
cacacggagaagcttattggagaa[G/T]atttcaaatcgaatgactccgcgg
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 1.91 | -0.73 | 1.75 |
Items per page:
1 – 1 of 1