rs76681900 chr18:55268710 T>G
- Sequence
tccaacatcaaaaactttcctaca[T/G]aagtgattcacgccacttccccaa
- ASB in cell types
- monocyte-derived dendritic cells primary B-CLL cells
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| monocyte-derived dendritic cells | -0.32 | 2.02 | 1.00 | |||
| primary B-CLL cells | 1.84 | n/a | 2.50 |
Items per page:
1 – 2 of 2